Projetos de pesquisa em andamento

Acesso a área restrita.

Entre para cadastrar ou atualizar seus projetos de pesquisa ou submeter novas solicitações de apoio a projetos.
Obter nova senha - Receber nome de usuário por e-mail - Criar uma conta

Projeto de pesquisa


  • Descrição do microbioma de corais de águas profundas

     
  • Coordenador do projeto: Marcelo Visentini Kitahara  
  • Autor ou executor principal do projeto: Aline Aparecida Zanotti  
  • Número do projeto: 1020  
  • Categoria: Doutorado 
  • Data de início das atividades no CEBIMar: 01/06/2019  
  • Data de término das atividades no CEBIMar: 24/06/2023  
  • Resumo: Os corais escleractíneos de águas profundas possuem poucos estudos a respeito dos micro-organismos simbiontes. São conhecidas cerca de 600 espécies de corais azooxantelados de águas profundas e aproximadamente 1% delas teve seu microbioma descrito. De modo geral, existem poucos estudos acerca da microbiologia dos corais escleractíneos, zooxantelados e azooxantelados. Entretanto os dados obtidos indicam que há uma relação intrínseca entre os micro-organismos e os corais hospedeiros, que pode ser considerada como parte do desenvolvimento e evolução de ambos e que responde a fatores ambientais, tais como sazonalidade, impactos antrópicos, mudanças de temperatura e doenças.  Nesse contexto, o presente projeto tem como objetivo documentar o microbioma de mais de 140 espécies de corais de águas profundas, coletados na Nova Caledônia, Atlântico Norte e África do Sul, possibilitando o aprimoramento da biodiversidade desses ambientes, o estabelecimento de um perfil do microbioma desses indivíduos/espécies, respostas do microbioma aos fatores ambientais, além da influencia dessa relação na diversidade e evolução de ambos, corais e micro-organismos.
     
  • Metodologia: A primeira etapa desse projeto tem como objetivo identificar a diversidade da comunidade de micro-organismos (i.e. Bacterias e Archaeas), associados a diversas espécies Cada amostra terá DNA genômico total extraído através do kit DNeasy PowerSoil Kit, visto que o mesmo remove inibidores de PCR, como por exemplo, os ácidos húmicos, em que os corais são ricos. Posteriormente, seguindo o protocolo 16S Metagenomic Sequencing Library Preparation (Illumina), iremos montar as bibliotecas que serão sequenciadas utilizando a plataforma MiSeq Illumina. Para isso realizaremos a amplificação do gene 16S rRNA através de reação de polimerase em cadeia (PCR) da região V3 e V4, utilizando marcadores bacterianos universais em conjunto com adaptadores Illumina: Iniciador F = 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCT ACGGGNGGCWGCAG e Iniciador R = 5' GTCTCGTGGGCTCGGAGATGTGTATAAG AGACAGGACTACHVGGGTATCTAATC. Posteriormente, será realizada a limpeza da PCR seguindo o protocolo da AMPure XP Beads, e o adicionamento dos indexes utilizando o kit Nextera XT Index Kit, que servem como identificadores de cada amostra. Após uma segunda limpeza utilizando o AMPure XP Beads, cada reação será quantificada e suas concentrações normalizadas. As amostras serão sequenciadas utilizando a plataforma MiSeq. Assim que as sequências forem obtidas, será aplicada uma sequência de análises de bioinformática com o intuito de identificar as bactérias e arqueias associadas a cada espécime de coral. Com os micro-organismos identificados, as análises estatísticas serão realizadas no STAMP - Statical Analysis of Metagenomic Profiles (PARKS et al., 2014), um programa criado para análises de perfis metagenômicos.
     
  • Etapas e cronograma: A primeira etapa do projeto será a organização dos dados de coleta. Assim que as amostras chegarem ao Brasil será realizado a extração de DNA, por tratar-se de mais de 400 amostras, essa etapa esta prevista para acabar em junho de 2020. Em paralelo, daremos início a PCR, assim que obtivermos as primeiras amostras com DNA extraído. Essa etapa contém algumas dificuldades como ajuste do protocolo, sendo assim esta prevista para finalizar em junho de 2021. Para adicionar os indexes, será necessário obter o produto da PCR, dessa forma está prevista para iniciar em janeiro de 2020 e finalizar em Junho de 2021. Com o fim dessa etapa, a preparação das amostras para o sequenciamento estará completa, sendo assim, o sequenciamento deve iniciar em junho de 2020 e acabar em dezembro de 2021. Como as amostras não ficarão prontas de uma única vez, esperamos dar início as análises de bioinformática em junho de 2020 e finalizar em junho de 2022, em paralelo serão realizadas as análises estatísticas das sequências já identificadas. A partir do início de 2021 esperamos já ter dados para começarmos e redação dos artigos e da tese, essa etapa deve finalizar com o fim do doutorado, em junho de 2023.
     
  • Palavras-chave: Águas profundas, corais azooxantelados, micro-organismos  
  • Condições ambientais: Nenhuma condição especial ;   
  • Área necessária no laboratório: Laboratórios de Biologia Molecular e Sala de balanças 
  • Equipamentos de laboratório: Capela de fluxo laminar, centrífuga, termociclador, termomixer, pipetas, cuba de eletroforese, Nanodrop, Qubit e autoclave. 
  • Outros serviços de laboratório: Nenhum 
  • Organismos a serem coletados: Nenhum 
  • Locais para coleta: Nenhum 
  • Tipos de resíduos químicos e/ou infectantes a serem gerados durante o projeto: Resíduos químicos: Buffer TAE, gel de agarose e álcool  
  • Quantidade de cada tipo de resíduo: Buffer TAE, cerca de 2 litros. Gel de agarose, cerca de 1kg Alcool, aproximadamente 2 litros
  • Periodicidade aproximada da geração dos resíduo: Aproximadamente 25% do total por semestre
  • Instituição(ções) de origem do projeto:

    • Outra instituição  UFPR 
    • USP. Centro de Biologia Marinha   
     
  • Participante(s) do projeto:

    Nenhum participante incluído.
     
  • Recurso(s) destinado(s) ao projeto:

    • Situação: Não informado 
    • Agência de fomento: Agência não informadaFAPESP 
    • Tipo de recurso: Escolha o tipo de recurso 
    • Especificar o tipo de recurso: Benefício complementar - Jovem Pesquisador 
    • Recursos em nome de: Marcelo Visentini Kitahara 
    • Situação: Concedido 
    • Agência de fomento: Fapesp 
    • Tipo de recurso: Auxílio á pesquisa 
    • Especificar o tipo de recurso: Benefício complementar - Jovem Pesquisador 
    • Recursos em nome de: Marcelo Visentini Kitahara 
     

    Produção(ões) bibliográfica(s) gerada(s) pelo projeto:

    Total de produções bibliográficas: 0


  • Data de cadastro do projeto: 24/05/2019  
  • Data da última modificação: 25/06/2019  

          

            Notícias

    

                  

Rodovia Manoel Hypólito do Rego, km. 131,5 - Pitangueiras - São Sebastião - SP - Brasil - CEP 11612-109 e-mail: O endereço de e-mail address está sendo protegido de spambots. Você precisa ativar o JavaScript enabled para vê-lo. O endereço de e-mail address está sendo protegido de spambots. Você precisa ativar o JavaScript enabled para vê-lo.             
Joomla 1.6 Templates designed by Joomla Hosting Reviews